E2F3 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

E2F3 cDNA ORF Clone, Human, untagged

E2F3 cDNA ORF Clone, Human, untagged

SPD-04686

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human E2F transcription factor 3.
Target Information
Species Human
Target Name E2F3
Gene Abbr. E2F3
Gene ID 1871
Full Name E2F transcription factor 3
Alias E2F-3
Product Details
Description Full length Clone DNA of Human E2F transcription factor 3.
NCBI Ref Seq BC016847
RefSeq ORF Size 402 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.