Online Inquiry
DYRK4 Knockout Cell Line
SPL-01199
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | DYRK4 |
| Gene Abbr. | DYRK4 |
| Gene ID | 8798 |
| Full Name | dual specificity tyrosine phosphorylation regulated kinase 4 |
| Species | Human |
| Genomic Locus | chr12:4596166 |
| Transcript | NM_003845 |
| WT Expression Level | 20.14 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes an enzyme that belongs to a conserved family of serine/threonine protein kinases. Members of this dual specificity kinase family are thought to function in the regulation of cell differentiation and proliferation, survival, and in development. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of DYRK4. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGCCTACCGCTATGAAGTTC |
| PCR Primer |
Forward: GTGCCCAGTGTAGTTAGAAAATTCC Reverse: ACACCTCTTCTTGTTCCTGATGATT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.