Online Inquiry
DYRK2 Knockout Cell Line
SPL-01197
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | DYRK2 |
| Gene Abbr. | DYRK2 |
| Gene ID | 8445 |
| Full Name | dual specificity tyrosine phosphorylation regulated kinase 2 |
| Species | Human |
| Genomic Locus | chr12:67657215 |
| Transcript | NM_003583 |
| WT Expression Level | 17.11 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of DYRK2. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGCTCACGACACAACCAAAT |
| PCR Primer |
Forward: CCATTTGAACAGACACCACTTCTTT Reverse: ATGCCTTCCATGGACTTTAGAGAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.