DYRK2 Knockout Cell Line - CD BioSciences

service-banner

DYRK2 Knockout Cell Line

DYRK2 Knockout Cell Line

SPL-01195

Size Price
1 Unit Online Inquiry
Description
16bp deletion
Target Information
Target Name DYRK2
Gene Abbr. DYRK2
Gene ID 8445
Full Name dual specificity tyrosine phosphorylation regulated kinase 2
Species Human
Genomic Locus chr12:67657215
Transcript NM_003583
WT Expression Level 17.11 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of DYRK2.
Description 16bp deletion
Parental Cell Line C631
Guide RNA Sequence TGCTCACGACACAACCAAAT
PCR Primer Forward: CCATTTGAACAGACACCACTTCTTT
Reverse: ATGCCTTCCATGGACTTTAGAGAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.