Online Inquiry
Dusp6 cDNA ORF Clone, Mouse, untagged
SPD-04650
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse dual specificity phosphatase 6 |
Target Information | |
---|---|
Species | Mouse |
Target Name | DUSP6/MKP3 |
Gene Abbr. | Dusp6 |
Gene ID | 67603 |
Full Name | dual specificity phosphatase 6 |
Alias | 1300019I03Rik, MKP, MKP-, MKP-3, MKP3 |
Introduction | MAP kinases are inactivated by dual-specificity protein phosphatases (DUSPs) that differ in their substrate specificity, tissue distribution, inducibility by extracellular stimuli, and cellular localization. DUSPs, also known as MAPK phosphatases (MKP), specifically dephosphorylate both threonine and tyrosine residues in MAPK P-loops and have been shown to play important roles in regulating the function of the MAPK family. At least 13 members of the family (DUSP1-10, DUSP14, DUSP16, and DUSP22) display unique substrate specificities for various MAP kinases. MAPK phosphatases typically contain an amino-terminal rhodanese-fold responsible for DUSP docking to MAPK family members and a carboxy-terminal catalytic domain. These phosphatases can play important roles in development, immune system function, stress responses, and metabolic homeostasis. In addition, research studies have implicated DUSPs in the development of cancer and the response of cancer cells to chemotherapy. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse dual specificity phosphatase 6 |
NCBI Ref Seq | NM_026268.3 |
RefSeq ORF Size | 1146 bp |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.