Dusp6 cDNA ORF Clone, Mouse, N-HA tag - CD BioSciences

service-banner

Dusp6 cDNA ORF Clone, Mouse, N-HA tag

Dusp6 cDNA ORF Clone, Mouse, N-HA tag

SPD-04648

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse dual specificity phosphatase 6 with N terminal HA tag.
Target Information
Species Mouse
Target Name DUSP6/MKP3
Gene Abbr. Dusp6
Gene ID 67603
Full Name dual specificity phosphatase 6
Alias 1300019I03Rik, MKP, MKP-, MKP-3, MKP3
Introduction MAP kinases are inactivated by dual-specificity protein phosphatases (DUSPs) that differ in their substrate specificity, tissue distribution, inducibility by extracellular stimuli, and cellular localization. DUSPs, also known as MAPK phosphatases (MKP), specifically dephosphorylate both threonine and tyrosine residues in MAPK P-loops and have been shown to play important roles in regulating the function of the MAPK family. At least 13 members of the family (DUSP1-10, DUSP14, DUSP16, and DUSP22) display unique substrate specificities for various MAP kinases. MAPK phosphatases typically contain an amino-terminal rhodanese-fold responsible for DUSP docking to MAPK family members and a carboxy-terminal catalytic domain. These phosphatases can play important roles in development, immune system function, stress responses, and metabolic homeostasis. In addition, research studies have implicated DUSPs in the development of cancer and the response of cancer cells to chemotherapy.
Product Details
Description Full length Clone DNA of Mouse dual specificity phosphatase 6 with N terminal HA tag.
NCBI Ref Seq NM_026268.3
RefSeq ORF Size 1146 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.