Online Inquiry
DNMT1 Knockout Cell Line
SPL-01157
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | DNMT1 |
| Gene Abbr. | DNMT1 |
| Gene ID | 1786 |
| Full Name | DNA methyltransferase 1 |
| Alias | ADCADN, AIM, CXXC9, DNMT, HSN1E |
| Species | Human |
| Genomic Locus | chr19:10175558 |
| Transcript | NM_001379 |
| WT Expression Level | 151.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes an enzyme that transfers methyl groups to cytosine nucleotides of genomic DNA. This protein is the major enzyme responsible for maintaining methylation patterns following DNA replication and shows a preference for hemi-methylated DNA. Methylation of DNA is an important component of mammalian epigenetic gene regulation. Aberrant methylation patterns are found in human tumors and associated with developmental abnormalities. Variation in this gene has been associated with cerebellar ataxia, deafness, and narcolepsy, and neuropathy, hereditary sensory, type IE. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of DNMT1. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTTGATGGACTCATCCGATT |
| PCR Primer |
Forward: AGCCCTAGACAGGGTTTTTATTTAC Reverse: TAGGACTTACAAGATGGCAAGACAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.