Online Inquiry
Dnm1 cDNA ORF Clone, Mouse, C-FLAG tag
SPD-04665
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse dynamin 1. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Dynamin |
| Gene Abbr. | Dnm1 |
| Gene ID | 13429 |
| Full Name | dynamin 1 |
| Alias | AI838169, Dnm, Ftf, Ftfl, mKIAA4093 |
| Introduction | Dynamin is a family of large GTPases that has been implicated in the formation of vesicles of both the endocytotic and secretory processes. Dynamin plays an important role in the internalization of cell surface receptors, a process that attenuates the response to extracellular signals. It has been illustrated that dynamin interacts with signaling proteins such as Src, PLCγ, PKC and G-proteins. PKC and Src phosphorylate dynamin, and its phosphorylation may regulate the endocytosis of cell surface receptors. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse dynamin 1. |
| NCBI Ref Seq | BC034679.1 |
| RefSeq ORF Size | 2643 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + XbaI (6kb + 2.64kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.