DNAJA1 Knockout Cell Line - CD BioSciences

service-banner

DNAJA1 Knockout Cell Line

DNAJA1 Knockout Cell Line

SPL-01151

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name DNAJA1
Gene Abbr. DNAJA1
Gene ID 3301
Full Name DnaJ heat shock protein family (Hsp40) member A1
Alias DJ-2, DjA1, HDJ2, HSDJ, HSJ-2
Species Human
Genomic Locus chr9:33026914
Transcript NM_001539
WT Expression Level 239.29 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the DnaJ family of proteins, which act as heat shock protein 70 cochaperones. Heat shock proteins facilitate protein folding, trafficking, prevention of aggregation, and proteolytic degradation. Members of this family are characterized by a highly conserved N-terminal J domain, a glycine/phenylalanine-rich region, four CxxCxGxG zinc finger repeats, and a C-terminal substrate-binding domain. The J domain mediates the interaction with heat shock protein 70 to recruit substrates and regulate ATP hydrolysis activity. In humans, this gene has been implicated in positive regulation of virus replication through co-option by the influenza A virus. Several pseudogenes of this gene are found on other chromosomes. [provided by RefSeq, Sep 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of DNAJA1.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence TGGCGGTTTTGGCTCCCCCA
PCR Primer Forward: ATTCACTCCTCTTTTCTCAAACAGT
Reverse: GGTGATTTCTCAAAGATCTGCTCTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.