Online Inquiry
DNAJA1 Knockout Cell Line
SPL-01150
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
145bp insertion |
Target Information | |
---|---|
Target Name | DNAJA1 |
Gene Abbr. | DNAJA1 |
Gene ID | 3301 |
Full Name | DnaJ heat shock protein family (Hsp40) member A1 |
Alias | DJ-2, DjA1, HDJ2, HSDJ, HSJ-2 |
Species | Human |
Genomic Locus | chr9:33026914 |
Transcript | NM_001539 |
WT Expression Level | 239.29 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the DnaJ family of proteins, which act as heat shock protein 70 cochaperones. Heat shock proteins facilitate protein folding, trafficking, prevention of aggregation, and proteolytic degradation. Members of this family are characterized by a highly conserved N-terminal J domain, a glycine/phenylalanine-rich region, four CxxCxGxG zinc finger repeats, and a C-terminal substrate-binding domain. The J domain mediates the interaction with heat shock protein 70 to recruit substrates and regulate ATP hydrolysis activity. In humans, this gene has been implicated in positive regulation of virus replication through co-option by the influenza A virus. Several pseudogenes of this gene are found on other chromosomes. [provided by RefSeq, Sep 2015]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 145bp insertion in a coding exon of DNAJA1. |
Description | 145bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | TGGCGGTTTTGGCTCCCCCA |
PCR Primer |
Forward: ATTCACTCCTCTTTTCTCAAACAGT Reverse: GGTGATTTCTCAAAGATCTGCTCTG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.