DMPK Knockout Cell Line - CD BioSciences

service-banner

DMPK Knockout Cell Line

DMPK Knockout Cell Line

SPL-01145

Size Price
1 Unit Online Inquiry
Description
28bp deletion
Target Information
Target Name DMPK
Gene Abbr. DMPK
Gene ID 1760
Full Name DM1 protein kinase
Alias DM, DM1, DM1PK, DMK, MDPK
Species Human
Genomic Locus chr19:45779794
Transcript NM_001081560
WT Expression Level 15.05 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a serine-threonine kinase that is closely related to other kinases that interact with members of the Rho family of small GTPases. Substrates for this enzyme include myogenin, the beta-subunit of the L-type calcium channels, and phospholemman. The 3' untranslated region of this gene contains 5-38 copies of a CTG trinucleotide repeat. Expansion of this unstable motif to 50-5,000 copies causes myotonic dystrophy type I, which increases in severity with increasing repeat element copy number. Repeat expansion is associated with condensation of local chromatin structure that disrupts the expression of genes in this region. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 28bp deletion in a coding exon of DMPK.
Description 28bp deletion
Parental Cell Line C631
Guide RNA Sequence ATTCTGAAGGTGATCGGACG
PCR Primer Forward: TGTAAAACGACGGCCAGTGGTGAAGCTGAGAGGCAGAG
Reverse: TCTTCAGCATGTCCCACTTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.