Online Inquiry
DLK2 cDNA ORF Clone, Human, N-Myc tag
SPD-04576
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human delta-like 2 homolog (Drosophila) with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | DLK2 |
Gene Abbr. | DLK2 |
Gene ID | 65989 |
Full Name | delta like non-canonical Notch ligand 2 |
Alias | DLK-2, EGFL9 |
Introduction | DLK2 (protein delta homolog 2) also called Epidermal growth factor-like protein 9 (EGFL9) is a 383 aminoacid protein with a molecular weight of 40.5 kDa. DLK2 is a single-pass type I membrane protein and is a negative regulator in the Notch pathway. DLK2 regulates adipogenesis and 2 isoforms of the human protein have been described. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human delta-like 2 homolog (Drosophila) with N terminal Myc tag. |
NCBI Ref Seq | BC000230 |
RefSeq ORF Size | 615 bp |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.