DLK1 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

DLK1 cDNA ORF Clone, Human, C-FLAG tag

DLK1 cDNA ORF Clone, Human, C-FLAG tag

SPD-04559

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human delta-like 1 homolog (Drosophila) with C terminal Flag tag.
Target Information
Species Human
Target Name DLK1
Gene Abbr. DLK1
Gene ID 8788
Full Name delta like non-canonical Notch ligand 1
Alias DLK, DLK-1, Delta1, FA1, PREF1
Introduction This gene encodes a transmembrane protein containing six epidermal growth factor repeats. The protein is involved in the differentiation of several cell types, including adipocytes; it is also thought to be a tumor suppressor. It is one of several imprinted genes located in a region of on chr 14q32. Certain mutations in this imprinted region can cause phenotypes similar to maternal and paternal uniparental disomy of chromosome 14 (UPD14). This gene is expressed from the paternal allele. A polymorphism within this gene has been associated with child and adolescent obesity. The mode of inheritance for this polymorphism is polar overdominance; this non-Mendelian inheritance pattern was first described in sheep with the callipyge phenotype, which is characterized by muscle hypertrophy and decreased fat mass. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Human delta-like 1 homolog (Drosophila) with C terminal Flag tag.
NCBI Ref Seq BC007741
RefSeq ORF Size 1152 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.