Online Inquiry
DLAT Knockout Cell Line
SPL-01136
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | DLAT |
| Gene Abbr. | DLAT |
| Gene ID | 1737 |
| Full Name | dihydrolipoamide S-acetyltransferase |
| Alias | DLTA, E2, PBC, PDC-E2, PDCE2 |
| Species | Human |
| Genomic Locus | chr11:112028609 |
| Transcript | NM_001931 |
| WT Expression Level | 70.67 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes component E2 of the multi-enzyme pyruvate dehydrogenase complex (PDC). PDC resides in the inner mitochondrial membrane and catalyzes the conversion of pyruvate to acetyl coenzyme A. The protein product of this gene, dihydrolipoamide acetyltransferase, accepts acetyl groups formed by the oxidative decarboxylation of pyruvate and transfers them to coenzyme A. Dihydrolipoamide acetyltransferase is the antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC enventually leads to cirrhosis and liver failure. Mutations in this gene are also a cause of pyruvate dehydrogenase E2 deficiency which causes primary lactic acidosis in infancy and early childhood.[provided by RefSeq, Oct 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of DLAT. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GATACAGATGATCGCTCCGA |
| PCR Primer |
Forward: ATACCAACAGTACAAACCTGAGCTA Reverse: CTCAGGCCTAAGGAAGAGAAAGAAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.