Online Inquiry
Dkk2 cDNA ORF Clone, Mouse, C-Myc tag
SPD-04510
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse dickkopf homolog 2 (Xenopus laevis) with C terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | DKK2 |
Gene Abbr. | Dkk2 |
Gene ID | 56811 |
Full Name | dickkopf WNT signaling pathway inhibitor 2 |
Introduction | Dishevelled (Dsh) proteins are important intermediates of Wnt signaling pathways. Dsh inhibits glycogen synthase kinase-3β promoting β-catenin stabilization. Dsh proteins also participate in the planar cell polarity pathway by acting through JNK. There are three Dsh homologs, Dvl1, Dvl2 and Dvl3 in mammals. Upon treatment with Wnt proteins, Dvls become hyperphosphorylated and accumulate in the nucleus. Dvl proteins also associate with actin fibers and cytoplasmic vesicular membranes and mediate endocytosis of the Fzd receptor after Wnt protein stimulation. Overexpression of Dvl has been reported in certain cancers. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse dickkopf homolog 2 (Xenopus laevis) with C terminal Myc tag. |
NCBI Ref Seq | NM_020265.3 |
RefSeq ORF Size | 780 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.