Dkk2 cDNA ORF Clone, Mouse, C-His tag - CD BioSciences

service-banner

Dkk2 cDNA ORF Clone, Mouse, C-His tag

Dkk2 cDNA ORF Clone, Mouse, C-His tag

SPD-04509

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse dickkopf homolog 2 (Xenopus laevis) with C terminal His tag.
Target Information
Species Mouse
Target Name DKK2
Gene Abbr. Dkk2
Gene ID 56811
Full Name dickkopf WNT signaling pathway inhibitor 2
Introduction Dishevelled (Dsh) proteins are important intermediates of Wnt signaling pathways. Dsh inhibits glycogen synthase kinase-3β promoting β-catenin stabilization. Dsh proteins also participate in the planar cell polarity pathway by acting through JNK. There are three Dsh homologs, Dvl1, Dvl2 and Dvl3 in mammals. Upon treatment with Wnt proteins, Dvls become hyperphosphorylated and accumulate in the nucleus. Dvl proteins also associate with actin fibers and cytoplasmic vesicular membranes and mediate endocytosis of the Fzd receptor after Wnt protein stimulation. Overexpression of Dvl has been reported in certain cancers.
Product Details
Description Full length Clone DNA of Mouse dickkopf homolog 2 (Xenopus laevis) with C terminal His tag.
NCBI Ref Seq NM_020265.3
RefSeq ORF Size 780 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.