Dkk1 cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Dkk1 cDNA ORF Clone, Mouse, C-FLAG tag

Dkk1 cDNA ORF Clone, Mouse, C-FLAG tag

SPD-04489

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse dickkopf homolog 1 (Xenopus laevis) with C terminal Flag tag.
Target Information
Species Mouse
Target Name DKK1
Gene Abbr. Dkk1
Gene ID 13380
Full Name dickkopf WNT signaling pathway inhibitor 1
Alias mdkk-1
Introduction Dickkopf (DKK) family proteins consist of four members DKK1, DKK2, DKK3 and DKK4 that function as secreted Wnt antagonists by inhibiting Wnt coreceptors LRP5 and LRP6. DKKs contain two cysteine-rich domains in which the positions of 10 cysteine residues are well conserved. Their expression is both temporally and spatially regulated during animal development. DKKs also bind with high affinity to transmembrane proteins Kremen1 and 2, which themselves also modulate Wnt signaling.DKK2 plays a role in osteoblast terminal differentiation and formation of mineralized matrix and is required for differentiation of non-keratinizing stratified epithelium from the corneal epithelial progenitors.
Product Details
Description Full length Clone DNA of Mouse dickkopf homolog 1 (Xenopus laevis) with C terminal Flag tag.
NCBI Ref Seq NM_010051.3
RefSeq ORF Size 819 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.