Online Inquiry
Dkk1 cDNA ORF Clone, Mouse, C-FLAG tag
SPD-04489
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse dickkopf homolog 1 (Xenopus laevis) with C terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | DKK1 |
Gene Abbr. | Dkk1 |
Gene ID | 13380 |
Full Name | dickkopf WNT signaling pathway inhibitor 1 |
Alias | mdkk-1 |
Introduction | Dickkopf (DKK) family proteins consist of four members DKK1, DKK2, DKK3 and DKK4 that function as secreted Wnt antagonists by inhibiting Wnt coreceptors LRP5 and LRP6. DKKs contain two cysteine-rich domains in which the positions of 10 cysteine residues are well conserved. Their expression is both temporally and spatially regulated during animal development. DKKs also bind with high affinity to transmembrane proteins Kremen1 and 2, which themselves also modulate Wnt signaling.DKK2 plays a role in osteoblast terminal differentiation and formation of mineralized matrix and is required for differentiation of non-keratinizing stratified epithelium from the corneal epithelial progenitors. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse dickkopf homolog 1 (Xenopus laevis) with C terminal Flag tag. |
NCBI Ref Seq | NM_010051.3 |
RefSeq ORF Size | 819 bp |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.