DKK1 cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

DKK1 cDNA ORF Clone, Human, C-Myc tag

DKK1 cDNA ORF Clone, Human, C-Myc tag

SPD-04500

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human dickkopf homolog 1 (Xenopus laevis) with C terminal Myc tag.
Target Information
Species Human
Target Name DKK1
Gene Abbr. DKK1
Gene ID 22943
Full Name dickkopf WNT signaling pathway inhibitor 1
Alias DKK-1, SK
Introduction Dickkopf (DKK) family proteins consist of four members DKK1, DKK2, DKK3 and DKK4 that function as secreted Wnt antagonists by inhibiting Wnt coreceptors LRP5 and LRP6. DKKs contain two cysteine-rich domains in which the positions of 10 cysteine residues are well conserved. Their expression is both temporally and spatially regulated during animal development. DKKs also bind with high affinity to transmembrane proteins Kremen1 and 2, which themselves also modulate Wnt signaling.DKK2 plays a role in osteoblast terminal differentiation and formation of mineralized matrix and is required for differentiation of non-keratinizing stratified epithelium from the corneal epithelial progenitors.
Product Details
Description Full length Clone DNA of Human dickkopf homolog 1 (Xenopus laevis) with C terminal Myc tag.
NCBI Ref Seq NM_012242.2
RefSeq ORF Size 795 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 0.85kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.