DIABLO cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

DIABLO cDNA ORF Clone, Human, N-FLAG tag

DIABLO cDNA ORF Clone, Human, N-FLAG tag

SPD-13827

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human diablo homolog (Drosophila), nuclear gene encoding mitochondrial protein, transcript variant 1 with N terminal Flag tag.
Target Information
Species Human
Target Name Smac/Diablo
Gene Abbr. DIABLO
Gene ID 56616
Full Name diablo IAP-binding mitochondrial protein
Alias DFNA64, SMAC
Introduction Smac/Diablo is a 21 kDa mammalian mitochondrial protein that functions as a regulatory component during apoptosis. Upon mitochondrial stress, Smac/Diablo is released from mitochondria and competes with caspases for binding of IAPs (inhibitor of apoptosis proteins). The interaction of Smac/Diablo with IAPs relieves the inhibitory effect of the IAPs on caspases. This interaction involves mainly the amino-terminal residues of Smac/Diablo with the BIR3 region of XIAP, supplemented with several other hydrophobic interactions between the helical structures of Smac/Diablo and other areas of BIR3.
Product Details
Description Full length Clone DNA of Human diablo homolog (Drosophila), nuclear gene encoding mitochondrial protein, transcript variant 1 with N terminal Flag tag.
NCBI Ref Seq NM_019887.3
RefSeq ORF Size 720 bp
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.