Online Inquiry
DIABLO cDNA ORF Clone, Cynomolgus, N-His tag
SPD-13818
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Cynomolgus diablo, IAP-binding mitochondrial protein with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Cynomolgus |
| Target Name | Smac/Diablo |
| Gene Abbr. | DIABLO |
| Gene ID | 102137478 |
| Full Name | diablo IAP-binding mitochondrial protein |
| Introduction | Smac/Diablo is a 21 kDa mammalian mitochondrial protein that functions as a regulatory component during apoptosis. Upon mitochondrial stress, Smac/Diablo is released from mitochondria and competes with caspases for binding of IAPs (inhibitor of apoptosis proteins). The interaction of Smac/Diablo with IAPs relieves the inhibitory effect of the IAPs on caspases. This interaction involves mainly the amino-terminal residues of Smac/Diablo with the BIR3 region of XIAP, supplemented with several other hydrophobic interactions between the helical structures of Smac/Diablo and other areas of BIR3. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Cynomolgus diablo, IAP-binding mitochondrial protein with N terminal His tag. |
| NCBI Ref Seq | XM_005572484.1 |
| RefSeq ORF Size | 561 bp |
| Vector | pCMV3-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.