Online Inquiry
DFFA cDNA ORF Clone, Human, N-HA tag
SPD-04486
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human DNA fragmentation factor, 45kDa, alpha polypeptide with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | DFF45 |
Gene Abbr. | DFFA |
Gene ID | 1676 |
Full Name | DNA fragmentation factor subunit alpha |
Alias | DFF-45, DFF1, ICAD |
Introduction | Human DFF45 and its mouse homologue ICAD function in normal cells as chaperones for caspase-activated deoxyribonuclease (DFF40 or CAD) during its synthesis. The association of DFF45 (or its isoform DFF35) with DFF40 inhibits the DNAse activity of the latter. In vitro, DFF45 has been shown to be the target of several caspases, including caspase-3, -6, -7, -8 and granzyme B. In vivo, caspase-3 is believed to be the primary enzyme responsible for processing DFF45 and release of its carboxy-terminal fragment. The cleavage of DFF45 inactivates its inhibitory function on DFF40 and causes nuclear DNA degradation by DFF40, leading to cell death. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human DNA fragmentation factor, 45kDa, alpha polypeptide with N terminal HA tag. |
NCBI Ref Seq | BC007721 |
RefSeq ORF Size | 996 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.