DFFA cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

DFFA cDNA ORF Clone, Human, N-FLAG tag

DFFA cDNA ORF Clone, Human, N-FLAG tag

SPD-04483

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human DNA fragmentation factor, 45kDa, alpha polypeptide with N terminal Flag tag.
Target Information
Species Human
Target Name DFF45
Gene Abbr. DFFA
Gene ID 1676
Full Name DNA fragmentation factor subunit alpha
Alias DFF-45, DFF1, ICAD
Introduction Human DFF45 and its mouse homologue ICAD function in normal cells as chaperones for caspase-activated deoxyribonuclease (DFF40 or CAD) during its synthesis. The association of DFF45 (or its isoform DFF35) with DFF40 inhibits the DNAse activity of the latter. In vitro, DFF45 has been shown to be the target of several caspases, including caspase-3, -6, -7, -8 and granzyme B. In vivo, caspase-3 is believed to be the primary enzyme responsible for processing DFF45 and release of its carboxy-terminal fragment. The cleavage of DFF45 inactivates its inhibitory function on DFF40 and causes nuclear DNA degradation by DFF40, leading to cell death.
Product Details
Description Full length Clone DNA of Human DNA fragmentation factor, 45kDa, alpha polypeptide with N terminal Flag tag.
NCBI Ref Seq BC007721
RefSeq ORF Size 996 bp
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.