Online Inquiry
DDX31 Knockout Cell Line
SPL-01121
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | DDX31 |
| Gene Abbr. | DDX31 |
| Gene ID | 64794 |
| Full Name | DEAD-box helicase 31 |
| Alias | PPP1R25 |
| Species | Human |
| Genomic Locus | chr9:132662625 |
| Transcript | NM_022779 |
| WT Expression Level | 19.09 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of DDX31. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTTTCGTTCCTCCGTTTCGC |
| PCR Primer |
Forward: AAGTCTTAATGCACTGTCTCTCCTC Reverse: AAGAAGCTGAGTCAAAGAGTCTGAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.