Online Inquiry
DDR2 Knockout Cell Line
SPL-01119
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
20bp deletion |
Target Information | |
---|---|
Target Name | DDR2 |
Gene Abbr. | DDR2 |
Gene ID | 4921 |
Full Name | discoidin domain receptor tyrosine kinase 2 |
Alias | MIG20a, NTRKR3, TKT, TYRO10, WRCN |
Species | Human |
Genomic Locus | chr1:162754826 |
Transcript | NM_006182 |
WT Expression Level | 17.20 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Receptor tyrosine kinases (RTKs) play a key role in the communication of cells with their microenvironment. These molecules are involved in the regulation of cell growth, differentiation, and metabolism. In several cases the biochemical mechanism by which RTKs transduce signals across the membrane has been shown to be ligand induced receptor oligomerization and subsequent intracellular phosphorylation. This autophosphorylation leads to phosphorylation of cytosolic targets as well as association with other molecules, which are involved in pleiotropic effects of signal transduction. RTKs have a tripartite structure with extracellular, transmembrane, and cytoplasmic regions. This gene encodes a member of a novel subclass of RTKs and contains a distinct extracellular region encompassing a factor VIII-like domain. Alternative splicing in the 5' UTR results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of DDR2. |
Description | 20bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | ATCTCTTGGCGGAACCGTCA |
PCR Primer |
Forward: TGAAGGAGTTTCTGCAGATTGACTT Reverse: GACACACATATCCACACAGAAAACC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.