DDR2 Knockout Cell Line - CD BioSciences

service-banner

DDR2 Knockout Cell Line

DDR2 Knockout Cell Line

SPL-01118

Size Price
1 Unit Online Inquiry
Description
13bp deletion
Target Information
Target Name DDR2
Gene Abbr. DDR2
Gene ID 4921
Full Name discoidin domain receptor tyrosine kinase 2
Alias MIG20a, NTRKR3, TKT, TYRO10, WRCN
Species Human
Genomic Locus chr1:162754826
Transcript NM_006182
WT Expression Level 17.20 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Receptor tyrosine kinases (RTKs) play a key role in the communication of cells with their microenvironment. These molecules are involved in the regulation of cell growth, differentiation, and metabolism. In several cases the biochemical mechanism by which RTKs transduce signals across the membrane has been shown to be ligand induced receptor oligomerization and subsequent intracellular phosphorylation. This autophosphorylation leads to phosphorylation of cytosolic targets as well as association with other molecules, which are involved in pleiotropic effects of signal transduction. RTKs have a tripartite structure with extracellular, transmembrane, and cytoplasmic regions. This gene encodes a member of a novel subclass of RTKs and contains a distinct extracellular region encompassing a factor VIII-like domain. Alternative splicing in the 5' UTR results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of DDR2.
Description 13bp deletion
Parental Cell Line C631
Guide RNA Sequence ATCTCTTGGCGGAACCGTCA
PCR Primer Forward: TGAAGGAGTTTCTGCAGATTGACTT
Reverse: GACACACATATCCACACAGAAAACC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.