Ddr1 cDNA ORF Clone, Mouse, N-HA tag - CD BioSciences

service-banner

Ddr1 cDNA ORF Clone, Mouse, N-HA tag

Ddr1 cDNA ORF Clone, Mouse, N-HA tag

SPD-04465

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse discoidin domain receptor family, member 1 with N terminal HA tag.
Target Information
Species Mouse
Target Name DDR1
Gene Abbr. Ddr1
Gene ID 12305
Full Name discoidin domain receptor family, member 1
Alias 6030432F18, AI323681, CD167, CD167a, Ca
Introduction The discoidin domain receptors (DDRs) are receptor tyrosine kinases with a discoidin homology repeat in their extracellular domains, activated by binding to extracellular matrix collagens. So far, two mammalian DDRs have been identified: DDR1 and DDR2. They are widely expressed in human tissues and may have roles in smooth muscle cell-mediated collagen remodeling. Research studies have implicated aberrant expression and signaling of DDRs in human diseases related to increased matrix degradation and remodeling, such as cardiovascular disease, liver fibrosis, and tumor invasion.
Product Details
Description Full length Clone DNA of Mouse discoidin domain receptor family, member 1 with N terminal HA tag.
NCBI Ref Seq NM_172962.1
RefSeq ORF Size 2625 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.