Online Inquiry
Ddr1 cDNA ORF Clone, Mouse, N-HA tag
SPD-04465
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse discoidin domain receptor family, member 1 with N terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | DDR1 |
Gene Abbr. | Ddr1 |
Gene ID | 12305 |
Full Name | discoidin domain receptor family, member 1 |
Alias | 6030432F18, AI323681, CD167, CD167a, Ca |
Introduction | The discoidin domain receptors (DDRs) are receptor tyrosine kinases with a discoidin homology repeat in their extracellular domains, activated by binding to extracellular matrix collagens. So far, two mammalian DDRs have been identified: DDR1 and DDR2. They are widely expressed in human tissues and may have roles in smooth muscle cell-mediated collagen remodeling. Research studies have implicated aberrant expression and signaling of DDRs in human diseases related to increased matrix degradation and remodeling, such as cardiovascular disease, liver fibrosis, and tumor invasion. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse discoidin domain receptor family, member 1 with N terminal HA tag. |
NCBI Ref Seq | NM_172962.1 |
RefSeq ORF Size | 2625 bp |
Vector | pCMV3-SP-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.