DDR1 cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

DDR1 cDNA ORF Clone, Human, N-Myc tag

DDR1 cDNA ORF Clone, Human, N-Myc tag

SPD-04474

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human discoidin domain receptor tyrosine kinase 1 , transcript variant 2 with N terminal Myc tag.
Target Information
Species Human
Target Name DDR1
Gene Abbr. DDR1
Gene ID 780
Full Name discoidin domain receptor tyrosine kinase 1
Alias CAK, CD167, DDR, EDDR1, HGK2
Introduction The discoidin domain receptors (DDRs) are receptor tyrosine kinases with a discoidin homology repeat in their extracellular domains, activated by binding to extracellular matrix collagens. So far, two mammalian DDRs have been identified: DDR1 and DDR2. They are widely expressed in human tissues and may have roles in smooth muscle cell-mediated collagen remodeling. Research studies have implicated aberrant expression and signaling of DDRs in human diseases related to increased matrix degradation and remodeling, such as cardiovascular disease, liver fibrosis, and tumor invasion.
Product Details
Description Full length Clone DNA of Human discoidin domain receptor tyrosine kinase 1 , transcript variant 2 with N terminal Myc tag.
NCBI Ref Seq NM_013993.2
RefSeq ORF Size 2742 bp
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.