Ddit3 cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Ddit3 cDNA ORF Clone, Mouse, N-His tag

Ddit3 cDNA ORF Clone, Mouse, N-His tag

SPD-03350

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse DNA-damage inducible transcript 3 with N terminal His tag.
Target Information
Species Mouse
Target Name CHOP
Gene Abbr. Ddit3
Gene ID 13198
Full Name DNA-damage inducible transcript 3
Alias AltDDIT3, CHOP-, CHOP-10, CHOP10, ch
Introduction CHOP was identified as a C/EBP-homologous protein that inhibits C/EBP and LAP in a dominant-negative manner. CHOP expression is induced by certain cellular stresses including starvation and the induced CHOP suppresses cell cycle progression from G1 to S phase. Later it was shown that, during ER stress, the level of CHOP expression is elevated and CHOP functions to mediate programmed cell death. Studies also found that CHOP mediates the activation of GADD34 and Ero1-Lα expression during ER stress. GADD34 in turn dephosphorylates phospho-Ser51 of eIF2α thereby stimulating protein synthesis. Ero1-Lα promotes oxidative stress inside the endoplasmic reticulum. The role of CHOP in the programmed cell death of ER-stressed cells is correlated with its role promoting protein synthesis and oxidative stress inside the ER.
Product Details
Description Full length Clone DNA of Mouse DNA-damage inducible transcript 3 with N terminal His tag.
NCBI Ref Seq NM_007837.4
RefSeq ORF Size 507 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.