Online Inquiry
DAXX cDNA ORF Clone, Human, C-HA tag
SPD-04454
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human death-domain associated protein |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Daxx |
| Gene Abbr. | DAXX |
| Gene ID | 1616 |
| Full Name | death domain associated protein |
| Alias | BING2, DAP6, EAP1, SMIM40 |
| Introduction | Daxx is a ubiquitously expressed protein that was originally identified through a yeast two-hybrid screen as an interactor with the cytoplasmic domain of Fas. It was found to enhance Fas-mediated apoptosis and activate the JNK pathway. However, additional studies have revealed that Daxx is actually a nuclear protein localizing to promyelocytic leukemia oncogenic domains (PODs). Nuclear interactions have since been observed with CENP-C Pax3 DNA methyltransferase I and chromatin-associated proteins, including histone deacetylase II, H2A, H2B, H3, H4 and Dek. Roles for Daxx have been suggested in transcriptional repression and cell cycle control. Loss of Daxx in mice leads to embryonic lethality with extensive developmental apoptosis, suggesting a role for Daxx directly or indirectly in suppressing cell death. Furthermore, inhibition of Daxx expression using RNAi has confirmed Daxx to be anti-apoptotic and to repress transcriptional activity of targets including NF-κB and E2F-1. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human death-domain associated protein |
| NCBI Ref Seq | NM_001350.4 |
| RefSeq ORF Size | 2265 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV mammalian cell promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | KpnI + XbaI (6kb + 2.27kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.