DAPK3 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

DAPK3 cDNA ORF Clone, Human, untagged

DAPK3 cDNA ORF Clone, Human, untagged

SPD-04452

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human death-associated protein kinase 3.
Target Information
Species Human
Target Name DAPK3
Gene Abbr. DAPK3
Gene ID 1613
Full Name death associated protein kinase 3
Alias DLK, ZIP, ZIPK
Introduction DAPK3, a DAPK type protein kinase, is functions in apoptotic signaling and also is believed to function in coordination of specific transcription and splicing events. DAPK3 contains a leucine zipper motif at its C terminus in addition to the N terminal kinase domain. DAPK3 binds to ATF4, a member of the activating transcription factor/cyclic AMP-responsive element-binding protein (ATF/CREB) family.
Product Details
Description Full length Clone DNA of Human death-associated protein kinase 3.
NCBI Ref Seq NM_001348.1
RefSeq ORF Size 1365 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 18 G>A and 324 A>G not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 1.37kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.