Online Inquiry
DAPK1 cDNA ORF Clone, Human, untagged
SPD-04442
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human death-associated protein kinase 1. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | DAPK1 |
| Gene Abbr. | DAPK1 |
| Gene ID | 1612 |
| Full Name | death associated protein kinase 1 |
| Alias | DAPK, ROCO3 |
| Introduction | Death-associated protein kinase (DAPK1) is a Ca2+/calmodulin-regulated serine/threonine kinase that participates in a wide range of apoptotic signals including interferon-γ, tumor necrosis factor α, Fas, activated c-Myc, and detachment from the extracellular matrix. In addition to the kinase domain and calmodulin regulatory segment, DAPK1 also has eight ankyrin repeats, a cytoskeleton binding region, and a conserved death domain. Deletion of the calmodulin-regulatory domain generates a constitutively active mutant kinase. Ectopic expression of wild-type DAPK1 induced cell death in HeLa cells. Conversely, expression of a catalytically inactive mutant protected cells from interferon-γ-induced cell death. The catalytic domain of DAPK1 has very high sequence similarity to vertebrate myosin light chain kinase (MLCK) and a RXX(S/T)X motif derived from myosin light chain protein was shown to be phosphorylated in vitro by DAPK1.Epigenetic silencing of DAPK1 by promoter methylation has been observed in cases of chronic lymphocytic leukemia. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human death-associated protein kinase 1. |
| NCBI Ref Seq | BC113660 |
| RefSeq ORF Size | 4293 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + NotI (6.1kb + 4.29kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.