Online Inquiry
CYP51A1 Knockout Cell Line
SPL-01092
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
11bp deletion |
Target Information | |
---|---|
Target Name | CYP51A1 |
Gene Abbr. | CYP51A1 |
Gene ID | 1595 |
Full Name | cytochrome P450 family 51 subfamily A member 1 |
Alias | CP51, CYP51, CYPL1, LDM, P450-14DM |
Species | Human |
Genomic Locus | chr7:92127574 |
Transcript | NM_000786 |
WT Expression Level | 75.05 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein participates in the synthesis of cholesterol by catalyzing the removal of the 14alpha-methyl group from lanosterol. Homologous genes are found in all three eukaryotic phyla, fungi, plants, and animals, suggesting that this is one of the oldest cytochrome P450 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of CYP51A1. |
Description | 11bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GTTTAAAGTGGGCTATGTTA |
PCR Primer |
Forward: TCATTACATAACCCTCCCATAAATCT Reverse: GCCCAAAGGGTTAAAACCATTACTT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.