CYP51A1 Knockout Cell Line - CD BioSciences

service-banner

CYP51A1 Knockout Cell Line

CYP51A1 Knockout Cell Line

SPL-01091

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name CYP51A1
Gene Abbr. CYP51A1
Gene ID 1595
Full Name cytochrome P450 family 51 subfamily A member 1
Alias CP51, CYP51, CYPL1, LDM, P450-14DM
Species Human
Genomic Locus chr7:92127574
Transcript NM_000786
WT Expression Level 75.05 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein participates in the synthesis of cholesterol by catalyzing the removal of the 14alpha-methyl group from lanosterol. Homologous genes are found in all three eukaryotic phyla, fungi, plants, and animals, suggesting that this is one of the oldest cytochrome P450 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of CYP51A1.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence GTTTAAAGTGGGCTATGTTA
PCR Primer Forward: TCATTACATAACCCTCCCATAAATCT
Reverse: GCCCAAAGGGTTAAAACCATTACTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.