CYCS cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

CYCS cDNA ORF Clone, Rhesus, untagged

CYCS cDNA ORF Clone, Rhesus, untagged

SPD-04431

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus cytochrome c, somatic.
Target Information
Species Rhesus
Target Name Cytochrome c
Gene Abbr. CYCS
Gene ID 100425223
Full Name cytochrome c, somatic
Introduction Cytochrome c is a well conserved electron-transport protein and is part of the respiratory chain localized to mitochondrial intermembrane space. Upon apoptotic stimulation, cytochrome c released from mitochondria associates with procaspase-9 (47 kDa)/Apaf 1. This complex processes caspase-9 from inactive proenzyme to its active form. This event further triggers caspase-3 activation and eventually leads to apoptosis.
Product Details
Description Full length Clone DNA of Rhesus cytochrome c, somatic.
NCBI Ref Seq XM_002803349.1
RefSeq ORF Size 318 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.