Online Inquiry
CYCS cDNA ORF Clone, Canine, N-FLAG tag
SPD-04396
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Canine cytochrome c, somatic with N terminal Flag tag. |
Target Information | |
---|---|
Species | Canine |
Target Name | Cytochrome c |
Gene Abbr. | CYCS |
Gene ID | 475258 |
Full Name | cytochrome c, somatic |
Introduction | Cytochrome c is a well conserved electron-transport protein and is part of the respiratory chain localized to mitochondrial intermembrane space. Upon apoptotic stimulation, cytochrome c released from mitochondria associates with procaspase-9 (47 kDa)/Apaf 1. This complex processes caspase-9 from inactive proenzyme to its active form. This event further triggers caspase-3 activation and eventually leads to apoptosis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Canine cytochrome c, somatic with N terminal Flag tag. |
NCBI Ref Seq | NM_001197045.1 |
RefSeq ORF Size | 318 bp |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.