CXCR4 cDNA ORF Clone, Rhesus, N-FLAG tag - CD BioSciences

service-banner

CXCR4 cDNA ORF Clone, Rhesus, N-FLAG tag

CXCR4 cDNA ORF Clone, Rhesus, N-FLAG tag

SPD-04225

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus chemokine (C-X-C motif) receptor 4 with N terminal Flag tag.
Target Information
Species Rhesus
Target Name CXCR4
Gene Abbr. CXCR4
Gene ID 707329
Full Name C-X-C motif chemokine receptor 4
Introduction CXCR4 is a chemokine receptor that belongs to the G protein-coupled receptor family. It is activated by a small cytokine, CXCL12, also known as stromal cell derived factor 1 (SDF-1). The main function of CXCR4 is the mediation of the homing of progenitor cells in the bone marrow and their recruitment to sites of injury. More recently, CXCR4 has been studied, as a potential therapeutic target, in the context of autoimmune diseases as well as cancer, as the receptor is involved in the regulation of migration, proliferation, and survival of cancer cells.
Product Details
Description Full length Clone DNA of Rhesus chemokine (C-X-C motif) receptor 4 with N terminal Flag tag.
NCBI Ref Seq NM_001042645.1
RefSeq ORF Size 1059 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 498C/T not causing the amino acid variation.
Please check the sequence information before order.
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.14kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.