Cxcr4 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Cxcr4 cDNA ORF Clone, Rat, untagged

Cxcr4 cDNA ORF Clone, Rat, untagged

SPD-04249

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat chemokine (C-X-C motif) receptor 4.
Target Information
Species Rat
Target Name CXCR4
Gene Abbr. Cxcr4
Gene ID 60628
Full Name C-X-C motif chemokine receptor 4
Introduction CXCR4 is a chemokine receptor that belongs to the G protein-coupled receptor family. It is activated by a small cytokine, CXCL12, also known as stromal cell derived factor 1 (SDF-1). The main function of CXCR4 is the mediation of the homing of progenitor cells in the bone marrow and their recruitment to sites of injury. More recently, CXCR4 has been studied, as a potential therapeutic target, in the context of autoimmune diseases as well as cancer, as the receptor is involved in the regulation of migration, proliferation, and survival of cancer cells.
Product Details
Description Full length Clone DNA of Rat chemokine (C-X-C motif) receptor 4.
NCBI Ref Seq NM_022205.3
RefSeq ORF Size 1050 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 1.05kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.