Online Inquiry
Cxcr4 cDNA ORF Clone, Rat, N-HA tag
SPD-04238
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Rat interleukin 8 receptor, beta with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Rat |
| Target Name | CXCR4 |
| Gene Abbr. | Cxcr4 |
| Gene ID | 60628 |
| Full Name | C-X-C motif chemokine receptor 4 |
| Introduction | CXCR4 is a chemokine receptor that belongs to the G protein-coupled receptor family. It is activated by a small cytokine, CXCL12, also known as stromal cell derived factor 1 (SDF-1). The main function of CXCR4 is the mediation of the homing of progenitor cells in the bone marrow and their recruitment to sites of injury. More recently, CXCR4 has been studied, as a potential therapeutic target, in the context of autoimmune diseases as well as cancer, as the receptor is involved in the regulation of migration, proliferation, and survival of cancer cells. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Rat interleukin 8 receptor, beta with N terminal HA tag. |
| NCBI Ref Seq | NM_017183.1 |
| RefSeq ORF Size | 1080 bp |
| Vector | pCMV3-SP-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.