CXCL8 cDNA ORF Clone, Canine, N-HA tag - CD BioSciences

service-banner

CXCL8 cDNA ORF Clone, Canine, N-HA tag

CXCL8 cDNA ORF Clone, Canine, N-HA tag

SPD-04199

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Canine interleukin 8 with N terminal HA tag.
Target Information
Species Canine
Target Name CXCL8
Gene Abbr. CXCL8
Gene ID 403850
Full Name C-X-C motif chemokine ligand 8
Introduction The protein encoded by this gene is a member of the CXC chemokine family. This chemokine is one of the major mediators of the inflammatory response. This chemokine is secreted by several cell types. It functions as a chemoattractant, and is also a potent angiogenic factor. This gene is believed to play a role in the pathogenesis of bronchiolitis, a common respiratory tract disease caused by viral infection. This gene and other ten members of the CXC chemokine gene family form a chemokine gene cluster in a region mapped to chromosome 4q. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Canine interleukin 8 with N terminal HA tag.
NCBI Ref Seq NM_001003200.1
RefSeq ORF Size 306 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.