Online Inquiry
CXCL8 cDNA ORF Clone, Canine, C-FLAG tag
SPD-04191
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Canine interleukin 8 with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Canine |
| Target Name | CXCL8 |
| Gene Abbr. | CXCL8 |
| Gene ID | 403850 |
| Full Name | C-X-C motif chemokine ligand 8 |
| Introduction | The protein encoded by this gene is a member of the CXC chemokine family. This chemokine is one of the major mediators of the inflammatory response. This chemokine is secreted by several cell types. It functions as a chemoattractant, and is also a potent angiogenic factor. This gene is believed to play a role in the pathogenesis of bronchiolitis, a common respiratory tract disease caused by viral infection. This gene and other ten members of the CXC chemokine gene family form a chemokine gene cluster in a region mapped to chromosome 4q. [provided by RefSeq] |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Canine interleukin 8 with C terminal Flag tag. |
| NCBI Ref Seq | NM_001003200.1 |
| RefSeq ORF Size | 306 bp |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.