Online Inquiry
Cxcl5 cDNA ORF Clone, Mouse, N-FLAG tag
SPD-04166
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse chemokine (C-X-C motif) ligand 5 with N terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | CXCL5 |
| Gene Abbr. | Cxcl5 |
| Gene ID | 20311 |
| Full Name | chemokine (C-X-C motif) ligand 5 |
| Alias | AMCF, AMCF-II, Cxcl, Cxcl6, ENA- |
| Introduction | CXCL5, also known as epithelial cell-derived neutrophil-activating peptide (ENA-78), is an 8 kDa proinflammatory member of the CXC subfamily of chemokines. Its Glu-Leu-Arg (ELR) motif confers angiogenic properties and distinguishes it from ELR-CXC chemokines which are angiostatic. Human CXCL5 shares 57% amino acid (aa) sequence identity with mouse and rat CXCL5. Among other human ELR+ chemokines, it shares 77% aa sequence identity with CXCL6/GCP-2 and35%‑51% with CXCL1/GRO alpha, CXCL2/GRO beta, CXCL3/GRO gamma, CXCL7/NAP-2, and CXCL8/IL-8. Inflammatory stimulation up-regulates CXCL5 production in multiple hematopoietic cell types, fibroblasts, endothelial cells, and vascular smooth muscle cells. In vivo, CXCL5 is elevated at sites of inflammation and pulmonary fibrosis where it promotes neutrophil infiltration and activation as well as angiogenesis. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse chemokine (C-X-C motif) ligand 5 with N terminal Flag tag. |
| NCBI Ref Seq | NM_009141.2 |
| RefSeq ORF Size | 399 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-SP-N-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + XbaI (6kb + 0.37kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.