CXCL5 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

CXCL5 cDNA ORF Clone, Human, untagged

CXCL5 cDNA ORF Clone, Human, untagged

SPD-04180

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 5.
Target Information
Species Human
Target Name CXCL5
Gene Abbr. CXCL5
Gene ID 6374
Full Name C-X-C motif chemokine ligand 5
Alias ENA-78, SCYB5
Introduction CXCL5, also known as epithelial cell-derived neutrophil-activating peptide (ENA-78), is an 8 kDa proinflammatory member of the CXC subfamily of chemokines. Its Glu-Leu-Arg (ELR) motif confers angiogenic properties and distinguishes it from ELR-CXC chemokines which are angiostatic. Human CXCL5 shares 57% amino acid (aa) sequence identity with mouse and rat CXCL5. Among other human ELR+ chemokines, it shares 77% aa sequence identity with CXCL6/GCP-2 and35%‑51% with CXCL1/GRO alpha, CXCL2/GRO beta, CXCL3/GRO gamma, CXCL7/NAP-2, and CXCL8/IL-8. Inflammatory stimulation up-regulates CXCL5 production in multiple hematopoietic cell types, fibroblasts, endothelial cells, and vascular smooth muscle cells. In vivo, CXCL5 is elevated at sites of inflammation and pulmonary fibrosis where it promotes neutrophil infiltration and activation as well as angiogenesis.
Product Details
Description Full length Clone DNA of Human chemokine (C-X-C motif) ligand 5.
NCBI Ref Seq NM_002994.3
RefSeq ORF Size 345 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.