Cxcl2 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Cxcl2 cDNA ORF Clone, Rat, untagged

Cxcl2 cDNA ORF Clone, Rat, untagged

SPD-04150

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat chemokine (C-X-C motif) ligand 2.
Target Information
Species Rat
Target Name CXCL2
Gene Abbr. Cxcl2
Gene ID 114105
Full Name C-X-C motif chemokine ligand 2
Alias Mip-2, Scyb2
Introduction Macrophage Inflammatory Protein-2 (MIP-2) was originally identified as a heparin-binding protein secreted from a murine macrophage cell line in response to endotoxin stimulation. Based on its protein and DNA sequences, MIP-2 is a member of the alpha (C-X-C) subfamily of chemokines.
Product Details
Description Full length Clone DNA of Rat chemokine (C-X-C motif) ligand 2.
NCBI Ref Seq NM_053647.1
RefSeq ORF Size 303 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.