Online Inquiry
Cxcl2 cDNA ORF Clone, Mouse, N-Myc tag
SPD-04138
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse chemokine (C-X-C motif) ligand 2 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | CXCL2 |
Gene Abbr. | Cxcl2 |
Gene ID | 20310 |
Full Name | chemokine (C-X-C motif) ligand 2 |
Alias | CINC, CINC-2a, GROb, Gr, Gro2 |
Introduction | Macrophage Inflammatory Protein-2 (MIP-2) was originally identified as a heparin-binding protein secreted from a murine macrophage cell line in response to endotoxin stimulation. Based on its protein and DNA sequences, MIP-2 is a member of the alpha (C-X-C) subfamily of chemokines. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse chemokine (C-X-C motif) ligand 2 with N terminal Myc tag. |
NCBI Ref Seq | NM_009140.2 |
RefSeq ORF Size | 303 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Restriction Sites | KpnI + XbaI (6kb + 0.32kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.