Cxcl10 cDNA ORF Clone, Rat, N-HA tag - CD BioSciences

service-banner

Cxcl10 cDNA ORF Clone, Rat, N-HA tag

Cxcl10 cDNA ORF Clone, Rat, N-HA tag

SPD-04108

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat chemokine (C-X-C motif) ligand 10 with N terminal HA tag.
Target Information
Species Rat
Target Name CXCL10
Gene Abbr. Cxcl10
Gene ID 245920
Full Name C-X-C motif chemokine ligand 10
Alias IP-10, Scyb10
Introduction CXCL10 was originally identified as an IFN-gamma -inducible gene in monocytes, fibroblasts and endothelial cells. It has since been shown that CXCL10 mRNA is also induced by LPS, IL-1 beta, TNF-alpha, IL-12, and viruses. Additional cell types that have been shown to express CXCL10 include activated T-lymphocytes, splenocytes, keratinocytes, osteoblasts, astrocytes, and smooth muscle cells. CXCL10 is also expressed in psoriatic and lepromatous lesions of skin. The mouse homologue of human CXCL10, CRG-2, has been cloned and shown to share approximately 67% amino acid sequence identity with human CXCL10. Human CXCL10 cDNA encodes a 98 amino acid (aa) residue precursor protein with a 21 aa residue signal peptide that is cleaved to form the 77 aa residue secreted protein. The amino acid sequence of CXCL10 identified the protein as a member of the chemokine alpha subfamily that lacks the ELR domain. CXCL10 has been shown to be a chemoattractant for activated T-lymphocytes. CXCL10 has been reported to be a potent inhibitor of angiogenesis and to display a potent thymus-dependent antitumor effect. A chemokine receptor specific for CXCL10 and Mig has been cloned and shown to be highly expressed in IL-2-activated T-lymphocytes.
Product Details
Description Full length Clone DNA of Rat chemokine (C-X-C motif) ligand 10 with N terminal HA tag.
NCBI Ref Seq NM_139089.1
RefSeq ORF Size 297 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.