Online Inquiry
Cxcl10 cDNA ORF Clone, Mouse, N-Myc tag
SPD-04118
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse chemokine (C-X-C motif) ligand 10 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | CXCL10 |
Gene Abbr. | Cxcl10 |
Gene ID | 15945 |
Full Name | chemokine (C-X-C motif) ligand 10 |
Alias | C7, CRG-, CRG-2, IN, INP10 |
Introduction | CXCL10 was originally identified as an IFN-gamma -inducible gene in monocytes, fibroblasts and endothelial cells. It has since been shown that CXCL10 mRNA is also induced by LPS, IL-1 beta, TNF-alpha, IL-12, and viruses. Additional cell types that have been shown to express CXCL10 include activated T-lymphocytes, splenocytes, keratinocytes, osteoblasts, astrocytes, and smooth muscle cells. CXCL10 is also expressed in psoriatic and lepromatous lesions of skin. The mouse homologue of human CXCL10, CRG-2, has been cloned and shown to share approximately 67% amino acid sequence identity with human CXCL10. Human CXCL10 cDNA encodes a 98 amino acid (aa) residue precursor protein with a 21 aa residue signal peptide that is cleaved to form the 77 aa residue secreted protein. The amino acid sequence of CXCL10 identified the protein as a member of the chemokine alpha subfamily that lacks the ELR domain. CXCL10 has been shown to be a chemoattractant for activated T-lymphocytes. CXCL10 has been reported to be a potent inhibitor of angiogenesis and to display a potent thymus-dependent antitumor effect. A chemokine receptor specific for CXCL10 and Mig has been cloned and shown to be highly expressed in IL-2-activated T-lymphocytes. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse chemokine (C-X-C motif) ligand 10 with N terminal Myc tag. |
NCBI Ref Seq | NM_021274.1 |
RefSeq ORF Size | 297 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Restriction Sites | KpnI + XbaI (6kb + 0.33kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.