CXCL10 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

CXCL10 cDNA ORF Clone, Human, untagged

CXCL10 cDNA ORF Clone, Human, untagged

SPD-04130

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 10.
Target Information
Species Human
Target Name CXCL10
Gene Abbr. CXCL10
Gene ID 3627
Full Name C-X-C motif chemokine ligand 10
Alias C7, IFI10, INP10, IP-10, SCYB10
Introduction CXCL10 was originally identified as an IFN-gamma -inducible gene in monocytes, fibroblasts and endothelial cells. It has since been shown that CXCL10 mRNA is also induced by LPS, IL-1 beta, TNF-alpha, IL-12, and viruses. Additional cell types that have been shown to express CXCL10 include activated T-lymphocytes, splenocytes, keratinocytes, osteoblasts, astrocytes, and smooth muscle cells. CXCL10 is also expressed in psoriatic and lepromatous lesions of skin. The mouse homologue of human CXCL10, CRG-2, has been cloned and shown to share approximately 67% amino acid sequence identity with human CXCL10. Human CXCL10 cDNA encodes a 98 amino acid (aa) residue precursor protein with a 21 aa residue signal peptide that is cleaved to form the 77 aa residue secreted protein. The amino acid sequence of CXCL10 identified the protein as a member of the chemokine alpha subfamily that lacks the ELR domain. CXCL10 has been shown to be a chemoattractant for activated T-lymphocytes. CXCL10 has been reported to be a potent inhibitor of angiogenesis and to display a potent thymus-dependent antitumor effect. A chemokine receptor specific for CXCL10 and Mig has been cloned and shown to be highly expressed in IL-2-activated T-lymphocytes.
Product Details
Description Full length Clone DNA of Human chemokine (C-X-C motif) ligand 10.
NCBI Ref Seq NM_001565.2
RefSeq ORF Size 297 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + NotI (6.1kb + 0.3kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.