Cxcl1 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Cxcl1 cDNA ORF Clone, Rat, untagged

Cxcl1 cDNA ORF Clone, Rat, untagged

SPD-04079

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha).
Target Information
Species Rat
Target Name CXCL1
Gene Abbr. Cxcl1
Gene ID 81503
Full Name C-X-C motif chemokine ligand 1
Alias CINC-1, Gro1
Introduction CXCL1, also known as KC and GRO alpha, is a CXC family chemokine that is expressed in fibroblasts, macrophages, and endothelial cells and interacts with CXCR2. CXCL1 is a potent neutrophil attractant and activator. It also promotes angiogenesis by inducing VEGF production by neutrophils. N-terminally truncated CXCL1 demonstrates increased potency in CXCR2 signaling. Mature mouse CXCL1 shares 96% and 64% aa sequence identity with rat and human CXCL1, respectively.
Product Details
Description Full length Clone DNA of Rat chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha).
NCBI Ref Seq NM_030845.1
RefSeq ORF Size 291 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.