Online Inquiry
Cxcl1 cDNA ORF Clone, Mouse, C-Myc tag
SPD-04082
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse chemokine (C-X-C motif) ligand 1 with C terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | CXCL1 |
Gene Abbr. | Cxcl1 |
Gene ID | 14825 |
Full Name | chemokine (C-X-C motif) ligand 1 |
Alias | F, Fsp, Gr, Gro1, KC |
Introduction | CXCL1, also known as KC and GRO alpha, is a CXC family chemokine that is expressed in fibroblasts, macrophages, and endothelial cells and interacts with CXCR2. CXCL1 is a potent neutrophil attractant and activator. It also promotes angiogenesis by inducing VEGF production by neutrophils. N-terminally truncated CXCL1 demonstrates increased potency in CXCR2 signaling. Mature mouse CXCL1 shares 96% and 64% aa sequence identity with rat and human CXCL1, respectively. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse chemokine (C-X-C motif) ligand 1 with C terminal Myc tag. |
NCBI Ref Seq | NM_008176.2 |
RefSeq ORF Size | 291 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.