Cttn cDNA ORF Clone, Mouse, C-Myc tag - CD BioSciences

service-banner

Cttn cDNA ORF Clone, Mouse, C-Myc tag

Cttn cDNA ORF Clone, Mouse, C-Myc tag

SPD-03800

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse cortactin with C terminal Myc tag.
Target Information
Species Mouse
Target Name Cortactin
Gene Abbr. Cttn
Gene ID 13043
Full Name cortactin
Alias 1110020L01Rik, Ems, Ems1
Introduction Cortactin is a cortical actin binding protein. Its amino-terminal acidic domain (NTA) associates with the Arp2/3 and WASP complex at F-actin branches. The central region of the protein contains six repeats of 37 amino acids that are important in F-actin binding and cross-linking. The carboxy-terminus contains a proline-rich region and an SH3 domain that can interact with numerous scaffolding proteins, such as CortBP1 and Shank3. Cortactin is involved in signaling events that coordinate actin reorganization during cell movement. The human cortactin homologue EMS1 is overexpressed in numerous cancers with poor patient prognosis. Cortactin may also play an important role in the organization of transmembrane receptors at postsynaptic densities (PSD) and tight junctions by linking scaffolding proteins to the actin network.Cortactin is phosphorylated at tyrosine residues 421, 466, and 482. Tyrosine phosphorylation of cortactin regulates cell motility rac1-mediated actin dynamics cadherin-dependent adhesion chemokine trafficking and chemokine-dependent chemotaxis.
Product Details
Description Full length Clone DNA of Mouse cortactin with C terminal Myc tag.
NCBI Ref Seq NM_007803.5
RefSeq ORF Size 1641 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.